diff options
Diffstat (limited to 'Tools/stringbench')
-rw-r--r-- | Tools/stringbench/README | 68 | ||||
-rwxr-xr-x | Tools/stringbench/stringbench.py | 1482 |
2 files changed, 1550 insertions, 0 deletions
diff --git a/Tools/stringbench/README b/Tools/stringbench/README new file mode 100644 index 00000000000..a271f12632a --- /dev/null +++ b/Tools/stringbench/README @@ -0,0 +1,68 @@ +stringbench is a set of performance tests comparing byte string +operations with unicode operations. The two string implementations +are loosely based on each other and sometimes the algorithm for one is +faster than the other. + +These test set was started at the Need For Speed sprint in Reykjavik +to identify which string methods could be sped up quickly and to +identify obvious places for improvement. + +Here is an example of a benchmark + + +@bench('"Andrew".startswith("A")', 'startswith single character', 1000) +def startswith_single(STR): + s1 = STR("Andrew") + s2 = STR("A") + s1_startswith = s1.startswith + for x in _RANGE_1000: + s1_startswith(s2) + +The bench decorator takes three parameters. The first is a short +description of how the code works. In most cases this is Python code +snippet. It is not the code which is actually run because the real +code is hand-optimized to focus on the method being tested. + +The second parameter is a group title. All benchmarks with the same +group title are listed together. This lets you compare different +implementations of the same algorithm, such as "t in s" +vs. "s.find(t)". + +The last is a count. Each benchmark loops over the algorithm either +100 or 1000 times, depending on the algorithm performance. The output +time is the time per benchmark call so the reader needs a way to know +how to scale the performance. + +These parameters become function attributes. + + +Here is an example of the output + + +========== count newlines +38.54 41.60 92.7 ...text.with.2000.newlines.count("\n") (*100) +========== early match, single character +1.14 1.18 96.8 ("A"*1000).find("A") (*1000) +0.44 0.41 105.6 "A" in "A"*1000 (*1000) +1.15 1.17 98.1 ("A"*1000).index("A") (*1000) + +The first column is the run time in milliseconds for byte strings. +The second is the run time for unicode strings. The third is a +percentage; byte time / unicode time. It's the percentage by which +unicode is faster than byte strings. + +The last column contains the code snippet and the repeat count for the +internal benchmark loop. + +The times are computed with 'timeit.py' which repeats the test more +and more times until the total time takes over 0.2 seconds, returning +the best time for a single iteration. + +The final line of the output is the cumulative time for byte and +unicode strings, and the overall performance of unicode relative to +bytes. For example + +4079.83 5432.25 75.1 TOTAL + +However, this has no meaning as it evenly weights every test. + diff --git a/Tools/stringbench/stringbench.py b/Tools/stringbench/stringbench.py new file mode 100755 index 00000000000..a0a21fa0b2e --- /dev/null +++ b/Tools/stringbench/stringbench.py @@ -0,0 +1,1482 @@ + +# Various microbenchmarks comparing unicode and byte string performance +# Please keep this file both 2.x and 3.x compatible! + +import timeit +import itertools +import operator +import re +import sys +import datetime +import optparse + +VERSION = '2.0' + +def p(*args): + sys.stdout.write(' '.join(str(s) for s in args) + '\n') + +if sys.version_info >= (3,): + BYTES = bytes_from_str = lambda x: x.encode('ascii') + UNICODE = unicode_from_str = lambda x: x +else: + BYTES = bytes_from_str = lambda x: x + UNICODE = unicode_from_str = lambda x: x.decode('ascii') + +class UnsupportedType(TypeError): + pass + + +p('stringbench v%s' % VERSION) +p(sys.version) +p(datetime.datetime.now()) + +REPEAT = 1 +REPEAT = 3 +#REPEAT = 7 + +if __name__ != "__main__": + raise SystemExit("Must run as main program") + +parser = optparse.OptionParser() +parser.add_option("-R", "--skip-re", dest="skip_re", + action="store_true", + help="skip regular expression tests") +parser.add_option("-8", "--8-bit", dest="bytes_only", + action="store_true", + help="only do 8-bit string benchmarks") +parser.add_option("-u", "--unicode", dest="unicode_only", + action="store_true", + help="only do Unicode string benchmarks") + + +_RANGE_1000 = list(range(1000)) +_RANGE_100 = list(range(100)) +_RANGE_10 = list(range(10)) + +dups = {} +def bench(s, group, repeat_count): + def blah(f): + if f.__name__ in dups: + raise AssertionError("Multiple functions with same name: %r" % + (f.__name__,)) + dups[f.__name__] = 1 + f.comment = s + f.is_bench = True + f.group = group + f.repeat_count = repeat_count + return f + return blah + +def uses_re(f): + f.uses_re = True + +####### 'in' comparisons + +@bench('"A" in "A"*1000', "early match, single character", 1000) +def in_test_quick_match_single_character(STR): + s1 = STR("A" * 1000) + s2 = STR("A") + for x in _RANGE_1000: + s2 in s1 + +@bench('"B" in "A"*1000', "no match, single character", 1000) +def in_test_no_match_single_character(STR): + s1 = STR("A" * 1000) + s2 = STR("B") + for x in _RANGE_1000: + s2 in s1 + + +@bench('"AB" in "AB"*1000', "early match, two characters", 1000) +def in_test_quick_match_two_characters(STR): + s1 = STR("AB" * 1000) + s2 = STR("AB") + for x in _RANGE_1000: + s2 in s1 + +@bench('"BC" in "AB"*1000', "no match, two characters", 1000) +def in_test_no_match_two_character(STR): + s1 = STR("AB" * 1000) + s2 = STR("BC") + for x in _RANGE_1000: + s2 in s1 + +@bench('"BC" in ("AB"*300+"C")', "late match, two characters", 1000) +def in_test_slow_match_two_characters(STR): + s1 = STR("AB" * 300+"C") + s2 = STR("BC") + for x in _RANGE_1000: + s2 in s1 + +@bench('s="ABC"*33; (s+"E") in ((s+"D")*300+s+"E")', + "late match, 100 characters", 100) +def in_test_slow_match_100_characters(STR): + m = STR("ABC"*33) + d = STR("D") + e = STR("E") + s1 = (m+d)*300 + m+e + s2 = m+e + for x in _RANGE_100: + s2 in s1 + +# Try with regex +@uses_re +@bench('s="ABC"*33; re.compile(s+"D").search((s+"D")*300+s+"E")', + "late match, 100 characters", 100) +def re_test_slow_match_100_characters(STR): + m = STR("ABC"*33) + d = STR("D") + e = STR("E") + s1 = (m+d)*300 + m+e + s2 = m+e + pat = re.compile(s2) + search = pat.search + for x in _RANGE_100: + search(s1) + + +#### same tests as 'in' but use 'find' + +@bench('("A"*1000).find("A")', "early match, single character", 1000) +def find_test_quick_match_single_character(STR): + s1 = STR("A" * 1000) + s2 = STR("A") + s1_find = s1.find + for x in _RANGE_1000: + s1_find(s2) + +@bench('("A"*1000).find("B")', "no match, single character", 1000) +def find_test_no_match_single_character(STR): + s1 = STR("A" * 1000) + s2 = STR("B") + s1_find = s1.find + for x in _RANGE_1000: + s1_find(s2) + + +@bench('("AB"*1000).find("AB")', "early match, two characters", 1000) +def find_test_quick_match_two_characters(STR): + s1 = STR("AB" * 1000) + s2 = STR("AB") + s1_find = s1.find + for x in _RANGE_1000: + s1_find(s2) + +@bench('("AB"*1000).find("BC")', "no match, two characters", 1000) +def find_test_no_match_two_character(STR): + s1 = STR("AB" * 1000) + s2 = STR("BC") + s1_find = s1.find + for x in _RANGE_1000: + s1_find(s2) + +@bench('("AB"*1000).find("CA")', "no match, two characters", 1000) +def find_test_no_match_two_character_bis(STR): + s1 = STR("AB" * 1000) + s2 = STR("CA") + s1_find = s1.find + for x in _RANGE_1000: + s1_find(s2) + +@bench('("AB"*300+"C").find("BC")', "late match, two characters", 1000) +def find_test_slow_match_two_characters(STR): + s1 = STR("AB" * 300+"C") + s2 = STR("BC") + s1_find = s1.find + for x in _RANGE_1000: + s1_find(s2) + +@bench('("AB"*300+"CA").find("CA")', "late match, two characters", 1000) +def find_test_slow_match_two_characters_bis(STR): + s1 = STR("AB" * 300+"CA") + s2 = STR("CA") + s1_find = s1.find + for x in _RANGE_1000: + s1_find(s2) + +@bench('s="ABC"*33; ((s+"D")*500+s+"E").find(s+"E")', + "late match, 100 characters", 100) +def find_test_slow_match_100_characters(STR): + m = STR("ABC"*33) + d = STR("D") + e = STR("E") + s1 = (m+d)*500 + m+e + s2 = m+e + s1_find = s1.find + for x in _RANGE_100: + s1_find(s2) + +@bench('s="ABC"*33; ((s+"D")*500+"E"+s).find("E"+s)', + "late match, 100 characters", 100) +def find_test_slow_match_100_characters_bis(STR): + m = STR("ABC"*33) + d = STR("D") + e = STR("E") + s1 = (m+d)*500 + e+m + s2 = e+m + s1_find = s1.find + for x in _RANGE_100: + s1_find(s2) + + +#### Same tests for 'rfind' + +@bench('("A"*1000).rfind("A")', "early match, single character", 1000) +def rfind_test_quick_match_single_character(STR): + s1 = STR("A" * 1000) + s2 = STR("A") + s1_rfind = s1.rfind + for x in _RANGE_1000: + s1_rfind(s2) + +@bench('("A"*1000).rfind("B")', "no match, single character", 1000) +def rfind_test_no_match_single_character(STR): + s1 = STR("A" * 1000) + s2 = STR("B") + s1_rfind = s1.rfind + for x in _RANGE_1000: + s1_rfind(s2) + + +@bench('("AB"*1000).rfind("AB")', "early match, two characters", 1000) +def rfind_test_quick_match_two_characters(STR): + s1 = STR("AB" * 1000) + s2 = STR("AB") + s1_rfind = s1.rfind + for x in _RANGE_1000: + s1_rfind(s2) + +@bench('("AB"*1000).rfind("BC")', "no match, two characters", 1000) +def rfind_test_no_match_two_character(STR): + s1 = STR("AB" * 1000) + s2 = STR("BC") + s1_rfind = s1.rfind + for x in _RANGE_1000: + s1_rfind(s2) + +@bench('("AB"*1000).rfind("CA")', "no match, two characters", 1000) +def rfind_test_no_match_two_character_bis(STR): + s1 = STR("AB" * 1000) + s2 = STR("CA") + s1_rfind = s1.rfind + for x in _RANGE_1000: + s1_rfind(s2) + +@bench('("C"+"AB"*300).rfind("CA")', "late match, two characters", 1000) +def rfind_test_slow_match_two_characters(STR): + s1 = STR("C" + "AB" * 300) + s2 = STR("CA") + s1_rfind = s1.rfind + for x in _RANGE_1000: + s1_rfind(s2) + +@bench('("BC"+"AB"*300).rfind("BC")', "late match, two characters", 1000) +def rfind_test_slow_match_two_characters_bis(STR): + s1 = STR("BC" + "AB" * 300) + s2 = STR("BC") + s1_rfind = s1.rfind + for x in _RANGE_1000: + s1_rfind(s2) + +@bench('s="ABC"*33; ("E"+s+("D"+s)*500).rfind("E"+s)', + "late match, 100 characters", 100) +def rfind_test_slow_match_100_characters(STR): + m = STR("ABC"*33) + d = STR("D") + e = STR("E") + s1 = e+m + (d+m)*500 + s2 = e+m + s1_rfind = s1.rfind + for x in _RANGE_100: + s1_rfind(s2) + +@bench('s="ABC"*33; (s+"E"+("D"+s)*500).rfind(s+"E")', + "late match, 100 characters", 100) +def rfind_test_slow_match_100_characters_bis(STR): + m = STR("ABC"*33) + d = STR("D") + e = STR("E") + s1 = m+e + (d+m)*500 + s2 = m+e + s1_rfind = s1.rfind + for x in _RANGE_100: + s1_rfind(s2) + + +#### Now with index. +# Skip the ones which fail because that would include exception overhead. + +@bench('("A"*1000).index("A")', "early match, single character", 1000) +def index_test_quick_match_single_character(STR): + s1 = STR("A" * 1000) + s2 = STR("A") + s1_index = s1.index + for x in _RANGE_1000: + s1_index(s2) + +@bench('("AB"*1000).index("AB")', "early match, two characters", 1000) +def index_test_quick_match_two_characters(STR): + s1 = STR("AB" * 1000) + s2 = STR("AB") + s1_index = s1.index + for x in _RANGE_1000: + s1_index(s2) + +@bench('("AB"*300+"C").index("BC")', "late match, two characters", 1000) +def index_test_slow_match_two_characters(STR): + s1 = STR("AB" * 300+"C") + s2 = STR("BC") + s1_index = s1.index + for x in _RANGE_1000: + s1_index(s2) + +@bench('s="ABC"*33; ((s+"D")*500+s+"E").index(s+"E")', + "late match, 100 characters", 100) +def index_test_slow_match_100_characters(STR): + m = STR("ABC"*33) + d = STR("D") + e = STR("E") + s1 = (m+d)*500 + m+e + s2 = m+e + s1_index = s1.index + for x in _RANGE_100: + s1_index(s2) + + +#### Same for rindex + +@bench('("A"*1000).rindex("A")', "early match, single character", 1000) +def rindex_test_quick_match_single_character(STR): + s1 = STR("A" * 1000) + s2 = STR("A") + s1_rindex = s1.rindex + for x in _RANGE_1000: + s1_rindex(s2) + +@bench('("AB"*1000).rindex("AB")', "early match, two characters", 1000) +def rindex_test_quick_match_two_characters(STR): + s1 = STR("AB" * 1000) + s2 = STR("AB") + s1_rindex = s1.rindex + for x in _RANGE_1000: + s1_rindex(s2) + +@bench('("C"+"AB"*300).rindex("CA")', "late match, two characters", 1000) +def rindex_test_slow_match_two_characters(STR): + s1 = STR("C" + "AB" * 300) + s2 = STR("CA") + s1_rindex = s1.rindex + for x in _RANGE_1000: + s1_rindex(s2) + +@bench('s="ABC"*33; ("E"+s+("D"+s)*500).rindex("E"+s)', + "late match, 100 characters", 100) +def rindex_test_slow_match_100_characters(STR): + m = STR("ABC"*33) + d = STR("D") + e = STR("E") + s1 = e + m + (d+m)*500 + s2 = e + m + s1_rindex = s1.rindex + for x in _RANGE_100: + s1_rindex(s2) + + +#### Same for partition + +@bench('("A"*1000).partition("A")', "early match, single character", 1000) +def partition_test_quick_match_single_character(STR): + s1 = STR("A" * 1000) + s2 = STR("A") + s1_partition = s1.partition + for x in _RANGE_1000: + s1_partition(s2) + +@bench('("A"*1000).partition("B")', "no match, single character", 1000) +def partition_test_no_match_single_character(STR): + s1 = STR("A" * 1000) + s2 = STR("B") + s1_partition = s1.partition + for x in _RANGE_1000: + s1_partition(s2) + + +@bench('("AB"*1000).partition("AB")', "early match, two characters", 1000) +def partition_test_quick_match_two_characters(STR): + s1 = STR("AB" * 1000) + s2 = STR("AB") + s1_partition = s1.partition + for x in _RANGE_1000: + s1_partition(s2) + +@bench('("AB"*1000).partition("BC")', "no match, two characters", 1000) +def partition_test_no_match_two_character(STR): + s1 = STR("AB" * 1000) + s2 = STR("BC") + s1_partition = s1.partition + for x in _RANGE_1000: + s1_partition(s2) + +@bench('("AB"*300+"C").partition("BC")', "late match, two characters", 1000) +def partition_test_slow_match_two_characters(STR): + s1 = STR("AB" * 300+"C") + s2 = STR("BC") + s1_partition = s1.partition + for x in _RANGE_1000: + s1_partition(s2) + +@bench('s="ABC"*33; ((s+"D")*500+s+"E").partition(s+"E")', + "late match, 100 characters", 100) +def partition_test_slow_match_100_characters(STR): + m = STR("ABC"*33) + d = STR("D") + e = STR("E") + s1 = (m+d)*500 + m+e + s2 = m+e + s1_partition = s1.partition + for x in _RANGE_100: + s1_partition(s2) + + +#### Same for rpartition + +@bench('("A"*1000).rpartition("A")', "early match, single character", 1000) +def rpartition_test_quick_match_single_character(STR): + s1 = STR("A" * 1000) + s2 = STR("A") + s1_rpartition = s1.rpartition + for x in _RANGE_1000: + s1_rpartition(s2) + +@bench('("A"*1000).rpartition("B")', "no match, single character", 1000) +def rpartition_test_no_match_single_character(STR): + s1 = STR("A" * 1000) + s2 = STR("B") + s1_rpartition = s1.rpartition + for x in _RANGE_1000: + s1_rpartition(s2) + + +@bench('("AB"*1000).rpartition("AB")', "early match, two characters", 1000) +def rpartition_test_quick_match_two_characters(STR): + s1 = STR("AB" * 1000) + s2 = STR("AB") + s1_rpartition = s1.rpartition + for x in _RANGE_1000: + s1_rpartition(s2) + +@bench('("AB"*1000).rpartition("BC")', "no match, two characters", 1000) +def rpartition_test_no_match_two_character(STR): + s1 = STR("AB" * 1000) + s2 = STR("BC") + s1_rpartition = s1.rpartition + for x in _RANGE_1000: + s1_rpartition(s2) + +@bench('("C"+"AB"*300).rpartition("CA")', "late match, two characters", 1000) +def rpartition_test_slow_match_two_characters(STR): + s1 = STR("C" + "AB" * 300) + s2 = STR("CA") + s1_rpartition = s1.rpartition + for x in _RANGE_1000: + s1_rpartition(s2) + +@bench('s="ABC"*33; ("E"+s+("D"+s)*500).rpartition("E"+s)', + "late match, 100 characters", 100) +def rpartition_test_slow_match_100_characters(STR): + m = STR("ABC"*33) + d = STR("D") + e = STR("E") + s1 = e + m + (d+m)*500 + s2 = e + m + s1_rpartition = s1.rpartition + for x in _RANGE_100: + s1_rpartition(s2) + + +#### Same for split(s, 1) + +@bench('("A"*1000).split("A", 1)', "early match, single character", 1000) +def split_test_quick_match_single_character(STR): + s1 = STR("A" * 1000) + s2 = STR("A") + s1_split = s1.split + for x in _RANGE_1000: + s1_split(s2, 1) + +@bench('("A"*1000).split("B", 1)', "no match, single character", 1000) +def split_test_no_match_single_character(STR): + s1 = STR("A" * 1000) + s2 = STR("B") + s1_split = s1.split + for x in _RANGE_1000: + s1_split(s2, 1) + + +@bench('("AB"*1000).split("AB", 1)', "early match, two characters", 1000) +def split_test_quick_match_two_characters(STR): + s1 = STR("AB" * 1000) + s2 = STR("AB") + s1_split = s1.split + for x in _RANGE_1000: + s1_split(s2, 1) + +@bench('("AB"*1000).split("BC", 1)', "no match, two characters", 1000) +def split_test_no_match_two_character(STR): + s1 = STR("AB" * 1000) + s2 = STR("BC") + s1_split = s1.split + for x in _RANGE_1000: + s1_split(s2, 1) + +@bench('("AB"*300+"C").split("BC", 1)', "late match, two characters", 1000) +def split_test_slow_match_two_characters(STR): + s1 = STR("AB" * 300+"C") + s2 = STR("BC") + s1_split = s1.split + for x in _RANGE_1000: + s1_split(s2, 1) + +@bench('s="ABC"*33; ((s+"D")*500+s+"E").split(s+"E", 1)', + "late match, 100 characters", 100) +def split_test_slow_match_100_characters(STR): + m = STR("ABC"*33) + d = STR("D") + e = STR("E") + s1 = (m+d)*500 + m+e + s2 = m+e + s1_split = s1.split + for x in _RANGE_100: + s1_split(s2, 1) + + +#### Same for rsplit(s, 1) + +@bench('("A"*1000).rsplit("A", 1)', "early match, single character", 1000) +def rsplit_test_quick_match_single_character(STR): + s1 = STR("A" * 1000) + s2 = STR("A") + s1_rsplit = s1.rsplit + for x in _RANGE_1000: + s1_rsplit(s2, 1) + +@bench('("A"*1000).rsplit("B", 1)', "no match, single character", 1000) +def rsplit_test_no_match_single_character(STR): + s1 = STR("A" * 1000) + s2 = STR("B") + s1_rsplit = s1.rsplit + for x in _RANGE_1000: + s1_rsplit(s2, 1) + + +@bench('("AB"*1000).rsplit("AB", 1)', "early match, two characters", 1000) +def rsplit_test_quick_match_two_characters(STR): + s1 = STR("AB" * 1000) + s2 = STR("AB") + s1_rsplit = s1.rsplit + for x in _RANGE_1000: + s1_rsplit(s2, 1) + +@bench('("AB"*1000).rsplit("BC", 1)', "no match, two characters", 1000) +def rsplit_test_no_match_two_character(STR): + s1 = STR("AB" * 1000) + s2 = STR("BC") + s1_rsplit = s1.rsplit + for x in _RANGE_1000: + s1_rsplit(s2, 1) + +@bench('("C"+"AB"*300).rsplit("CA", 1)', "late match, two characters", 1000) +def rsplit_test_slow_match_two_characters(STR): + s1 = STR("C" + "AB" * 300) + s2 = STR("CA") + s1_rsplit = s1.rsplit + for x in _RANGE_1000: + s1_rsplit(s2, 1) + +@bench('s="ABC"*33; ("E"+s+("D"+s)*500).rsplit("E"+s, 1)', + "late match, 100 characters", 100) +def rsplit_test_slow_match_100_characters(STR): + m = STR("ABC"*33) + d = STR("D") + e = STR("E") + s1 = e + m + (d+m)*500 + s2 = e + m + s1_rsplit = s1.rsplit + for x in _RANGE_100: + s1_rsplit(s2, 1) + + +#### Benchmark the operator-based methods + +@bench('"A"*10', "repeat 1 character 10 times", 1000) +def repeat_single_10_times(STR): + s = STR("A") + for x in _RANGE_1000: + s * 10 + +@bench('"A"*1000', "repeat 1 character 1000 times", 1000) +def repeat_single_1000_times(STR): + s = STR("A") + for x in _RANGE_1000: + s * 1000 + +@bench('"ABCDE"*10', "repeat 5 characters 10 times", 1000) +def repeat_5_10_times(STR): + s = STR("ABCDE") + for x in _RANGE_1000: + s * 10 + +@bench('"ABCDE"*1000', "repeat 5 characters 1000 times", 1000) +def repeat_5_1000_times(STR): + s = STR("ABCDE") + for x in _RANGE_1000: + s * 1000 + +# + for concat + +@bench('"Andrew"+"Dalke"', "concat two strings", 1000) +def concat_two_strings(STR): + s1 = STR("Andrew") + s2 = STR("Dalke") + for x in _RANGE_1000: + s1+s2 + +@bench('s1+s2+s3+s4+...+s20', "concat 20 strings of words length 4 to 15", + 1000) +def concat_many_strings(STR): + s1=STR('TIXSGYNREDCVBHJ') + s2=STR('PUMTLXBZVDO') + s3=STR('FVZNJ') + s4=STR('OGDXUW') + s5=STR('WEIMRNCOYVGHKB') + s6=STR('FCQTNMXPUZH') + s7=STR('TICZJYRLBNVUEAK') + s8=STR('REYB') + s9=STR('PWUOQ') + s10=STR('EQHCMKBS') + s11=STR('AEVDFOH') + s12=STR('IFHVD') + s13=STR('JGTCNLXWOHQ') + s14=STR('ITSKEPYLROZAWXF') + s15=STR('THEK') + s16=STR('GHPZFBUYCKMNJIT') + s17=STR('JMUZ') + s18=STR('WLZQMTB') + s19=STR('KPADCBW') + s20=STR('TNJHZQAGBU') + for x in _RANGE_1000: + (s1 + s2+ s3+ s4+ s5+ s6+ s7+ s8+ s9+s10+ + s11+s12+s13+s14+s15+s16+s17+s18+s19+s20) + + +#### Benchmark join + +def get_bytes_yielding_seq(STR, arg): + if STR is BYTES and sys.version_info >= (3,): + raise UnsupportedType + return STR(arg) + +@bench('"A".join("")', + "join empty string, with 1 character sep", 100) +def join_empty_single(STR): + sep = STR("A") + s2 = get_bytes_yielding_seq(STR, "") + sep_join = sep.join + for x in _RANGE_100: + sep_join(s2) + +@bench('"ABCDE".join("")', + "join empty string, with 5 character sep", 100) +def join_empty_5(STR): + sep = STR("ABCDE") + s2 = get_bytes_yielding_seq(STR, "") + sep_join = sep.join + for x in _RANGE_100: + sep_join(s2) + +@bench('"A".join("ABC..Z")', + "join string with 26 characters, with 1 character sep", 1000) +def join_alphabet_single(STR): + sep = STR("A") + s2 = get_bytes_yielding_seq(STR, "ABCDEFGHIJKLMnOPQRSTUVWXYZ") + sep_join = sep.join + for x in _RANGE_1000: + sep_join(s2) + +@bench('"ABCDE".join("ABC..Z")', + "join string with 26 characters, with 5 character sep", 1000) +def join_alphabet_5(STR): + sep = STR("ABCDE") + s2 = get_bytes_yielding_seq(STR, "ABCDEFGHIJKLMnOPQRSTUVWXYZ") + sep_join = sep.join + for x in _RANGE_1000: + sep_join(s2) + +@bench('"A".join(list("ABC..Z"))', + "join list of 26 characters, with 1 character sep", 1000) +def join_alphabet_list_single(STR): + sep = STR("A") + s2 = [STR(x) for x in "ABCDEFGHIJKLMnOPQRSTUVWXYZ"] + sep_join = sep.join + for x in _RANGE_1000: + sep_join(s2) + +@bench('"ABCDE".join(list("ABC..Z"))', + "join list of 26 characters, with 5 character sep", 1000) +def join_alphabet_list_five(STR): + sep = STR("ABCDE") + s2 = [STR(x) for x in "ABCDEFGHIJKLMnOPQRSTUVWXYZ"] + sep_join = sep.join + for x in _RANGE_1000: + sep_join(s2) + +@bench('"A".join(["Bob"]*100))', + "join list of 100 words, with 1 character sep", 1000) +def join_100_words_single(STR): + sep = STR("A") + s2 = [STR("Bob")]*100 + sep_join = sep.join + for x in _RANGE_1000: + sep_join(s2) + +@bench('"ABCDE".join(["Bob"]*100))', + "join list of 100 words, with 5 character sep", 1000) +def join_100_words_5(STR): + sep = STR("ABCDE") + s2 = [STR("Bob")]*100 + sep_join = sep.join + for x in _RANGE_1000: + sep_join(s2) + +#### split tests + +@bench('("Here are some words. "*2).split()', "split whitespace (small)", 1000) +def whitespace_split(STR): + s = STR("Here are some words. "*2) + s_split = s.split + for x in _RANGE_1000: + s_split() + +@bench('("Here are some words. "*2).rsplit()', "split whitespace (small)", 1000) +def whitespace_rsplit(STR): + s = STR("Here are some words. "*2) + s_rsplit = s.rsplit + for x in _RANGE_1000: + s_rsplit() + +@bench('("Here are some words. "*2).split(None, 1)', + "split 1 whitespace", 1000) +def whitespace_split_1(STR): + s = STR("Here are some words. "*2) + s_split = s.split + N = None + for x in _RANGE_1000: + s_split(N, 1) + +@bench('("Here are some words. "*2).rsplit(None, 1)', + "split 1 whitespace", 1000) +def whitespace_rsplit_1(STR): + s = STR("Here are some words. "*2) + s_rsplit = s.rsplit + N = None + for x in _RANGE_1000: + s_rsplit(N, 1) + +@bench('("Here are some words. "*2).partition(" ")', + "split 1 whitespace", 1000) +def whitespace_partition(STR): + sep = STR(" ") + s = STR("Here are some words. "*2) + s_partition = s.partition + for x in _RANGE_1000: + s_partition(sep) + +@bench('("Here are some words. "*2).rpartition(" ")', + "split 1 whitespace", 1000) +def whitespace_rpartition(STR): + sep = STR(" ") + s = STR("Here are some words. "*2) + s_rpartition = s.rpartition + for x in _RANGE_1000: + s_rpartition(sep) + +human_text = """\ +Python is a dynamic object-oriented programming language that can be +used for many kinds of software development. It offers strong support +for integration with other languages and tools, comes with extensive +standard libraries, and can be learned in a few days. Many Python +programmers report substantial productivity gains and feel the language +encourages the development of higher quality, more maintainable code. + +Python runs on Windows, Linux/Unix, Mac OS X, OS/2, Amiga, Palm +Handhelds, and Nokia mobile phones. Python has also been ported to the +Java and .NET virtual machines. + +Python is distributed under an OSI-approved open source license that +makes it free to use, even for commercial products. +"""*25 +human_text_bytes = bytes_from_str(human_text) +human_text_unicode = unicode_from_str(human_text) +def _get_human_text(STR): + if STR is UNICODE: + return human_text_unicode + if STR is BYTES: + return human_text_bytes + raise AssertionError + +@bench('human_text.split()', "split whitespace (huge)", 10) +def whitespace_split_huge(STR): + s = _get_human_text(STR) + s_split = s.split + for x in _RANGE_10: + s_split() + +@bench('human_text.rsplit()', "split whitespace (huge)", 10) +def whitespace_rsplit_huge(STR): + s = _get_human_text(STR) + s_rsplit = s.rsplit + for x in _RANGE_10: + s_rsplit() + + + +@bench('"this\\nis\\na\\ntest\\n".split("\\n")', "split newlines", 1000) +def newlines_split(STR): + s = STR("this\nis\na\ntest\n") + s_split = s.split + nl = STR("\n") + for x in _RANGE_1000: + s_split(nl) + + +@bench('"this\\nis\\na\\ntest\\n".rsplit("\\n")', "split newlines", 1000) +def newlines_rsplit(STR): + s = STR("this\nis\na\ntest\n") + s_rsplit = s.rsplit + nl = STR("\n") + for x in _RANGE_1000: + s_rsplit(nl) + +@bench('"this\\nis\\na\\ntest\\n".splitlines()', "split newlines", 1000) +def newlines_splitlines(STR): + s = STR("this\nis\na\ntest\n") + s_splitlines = s.splitlines + for x in _RANGE_1000: + s_splitlines() + +## split text with 2000 newlines + +def _make_2000_lines(): + import random + r = random.Random(100) + chars = list(map(chr, range(32, 128))) + i = 0 + while i < len(chars): + chars[i] = " " + i += r.randrange(9) + s = "".join(chars) + s = s*4 + words = [] + for i in range(2000): + start = r.randrange(96) + n = r.randint(5, 65) + words.append(s[start:start+n]) + return "\n".join(words)+"\n" + +_text_with_2000_lines = _make_2000_lines() +_text_with_2000_lines_bytes = bytes_from_str(_text_with_2000_lines) +_text_with_2000_lines_unicode = unicode_from_str(_text_with_2000_lines) +def _get_2000_lines(STR): + if STR is UNICODE: + return _text_with_2000_lines_unicode + if STR is BYTES: + return _text_with_2000_lines_bytes + raise AssertionError + + +@bench('"...text...".split("\\n")', "split 2000 newlines", 10) +def newlines_split_2000(STR): + s = _get_2000_lines(STR) + s_split = s.split + nl = STR("\n") + for x in _RANGE_10: + s_split(nl) + +@bench('"...text...".rsplit("\\n")', "split 2000 newlines", 10) +def newlines_rsplit_2000(STR): + s = _get_2000_lines(STR) + s_rsplit = s.rsplit + nl = STR("\n") + for x in _RANGE_10: + s_rsplit(nl) + +@bench('"...text...".splitlines()', "split 2000 newlines", 10) +def newlines_splitlines_2000(STR): + s = _get_2000_lines(STR) + s_splitlines = s.splitlines + for x in _RANGE_10: + s_splitlines() + + +## split text on "--" characters +@bench( + '"this--is--a--test--of--the--emergency--broadcast--system".split("--")', + "split on multicharacter separator (small)", 1000) +def split_multichar_sep_small(STR): + s = STR("this--is--a--test--of--the--emergency--broadcast--system") + s_split = s.split + pat = STR("--") + for x in _RANGE_1000: + s_split(pat) +@bench( + '"this--is--a--test--of--the--emergency--broadcast--system".rsplit("--")', + "split on multicharacter separator (small)", 1000) +def rsplit_multichar_sep_small(STR): + s = STR("this--is--a--test--of--the--emergency--broadcast--system") + s_rsplit = s.rsplit + pat = STR("--") + for x in _RANGE_1000: + s_rsplit(pat) + +## split dna text on "ACTAT" characters +@bench('dna.split("ACTAT")', + "split on multicharacter separator (dna)", 10) +def split_multichar_sep_dna(STR): + s = _get_dna(STR) + s_split = s.split + pat = STR("ACTAT") + for x in _RANGE_10: + s_split(pat) + +@bench('dna.rsplit("ACTAT")', + "split on multicharacter separator (dna)", 10) +def rsplit_multichar_sep_dna(STR): + s = _get_dna(STR) + s_rsplit = s.rsplit + pat = STR("ACTAT") + for x in _RANGE_10: + s_rsplit(pat) + + + +## split with limits + +GFF3_example = "\t".join([ + "I", "Genomic_canonical", "region", "357208", "396183", ".", "+", ".", + "ID=Sequence:R119;note=Clone R119%3B Genbank AF063007;Name=R119"]) + +@bench('GFF3_example.split("\\t")', "tab split", 1000) +def tab_split_no_limit(STR): + sep = STR("\t") + s = STR(GFF3_example) + s_split = s.split + for x in _RANGE_1000: + s_split(sep) + +@bench('GFF3_example.split("\\t", 8)', "tab split", 1000) +def tab_split_limit(STR): + sep = STR("\t") + s = STR(GFF3_example) + s_split = s.split + for x in _RANGE_1000: + s_split(sep, 8) + +@bench('GFF3_example.rsplit("\\t")', "tab split", 1000) +def tab_rsplit_no_limit(STR): + sep = STR("\t") + s = STR(GFF3_example) + s_rsplit = s.rsplit + for x in _RANGE_1000: + s_rsplit(sep) + +@bench('GFF3_example.rsplit("\\t", 8)', "tab split", 1000) +def tab_rsplit_limit(STR): + sep = STR("\t") + s = STR(GFF3_example) + s_rsplit = s.rsplit + for x in _RANGE_1000: + s_rsplit(sep, 8) + +#### Count characters + +@bench('...text.with.2000.newlines.count("\\n")', + "count newlines", 10) +def count_newlines(STR): + s = _get_2000_lines(STR) + s_count = s.count + nl = STR("\n") + for x in _RANGE_10: + s_count(nl) + +# Orchid sequences concatenated, from Biopython +_dna = """ +CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGGGTT +AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGAATTGCCATCG +AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCTCCAAGTCGTT +TGACACATAATTGGTGAAGGGGGTGGCATCCTTCCCTGACCCTCCCCCAACTATTTTTTTAACAACTCTC +AGCAACGGAGACTCAGTCTTCGGCAAATGCGATAAATGGTGTGAATTGCAGAATCCCGTGCACCATCGAG +TCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATAT +CTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTT +TGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAGGTGGACGAACTAT +GCTACAACAAAATTGTTGTGCAGAGGCCCCGGGTTGTCGTATTAGATGGGCCACCGTAATCTGAAGACCC +TTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGCGACCCCAGGTCAG +GTGAGCAACAGCTGTCGTAACAAGGTTTCCGTAGGGTGAACTGCGGAAGGATCATTGTTGAGATCACATA +ATAATTGATCGAGTTAATCTGGAGGATCTGTTTACTTGGGTCACCCATGGGCATTTGCTGTTGAAGTGAC +CTAGATTTGCCATCGAGCCTCCTTGGGAGCATCCTTGTTGGCGATATCTAAACCCTCAATTTTTCCCCCA +ATCAAATTACACAAAATTGGTGGAGGGGGTGGCATTCTTCCCTTACCCTCCCCCAAATATTTTTTTAACA +ACTCTCAGCAACGGATATCTCAGCTCTTGCATCGATGAAGAACCCACCGAAATGCGATAAATGGTGTGAA +TTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACG +CCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCG +GATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGATGCATGGGCTTTTGATGGTCCTAA +ATACGGCAAGAGGTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATAAG +ATGGGCCACCGATATCTGAAGACCCTTTTGGACCCCATTGGAGCCCATCAACCCATGTCAGTTGATGGCC +ATTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGA +GTTAATCTGGAGGATCTGTTTACTTGGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCA +TCGAGCCTCCTTGGGAGCTTTCTTGTTGGCGATATCTAAACCCTTGCCCGGCAGAGTTTTGGGAATCCCG +TGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCAT +TGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACACACCTGTTCAGCCGGTGCGGATGTGAGTTTG +GCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAG +GTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGGGCCACCAT +AATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGC +GACCCAGTCAGGTGAGGGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAG +TTAATCTGGAGGATCTGTTTACTTTGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCAT +CGAGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGGAGTTTGGCGCCAAGTCA +TATGACACATAATTGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAACAACTC +TCAGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGC +AGAATCCCGTGAACCATCGAGTCTTTGGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCT +GCCTGGGCATTGGGAATCATATCTCTCCCCTAACGAGGCTATCCAAACATACTGTTCATCCGGTGCGGAT +GTGAGTTTGGCCCCTTGTTCTTTGGTACCGGGGGTCTAAGAGCTGCATGGGCATTTGATGGTCCTCAAAA +CGGCAAGAGGTGGACGAACTATGCCACAACAAAATTGTTGTCCCAAGGCCCCGGGTTGTCGTATTAGATG +GGCCACCGTAACCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGACCA +TTTGTTGCGACCCCAGTCAGCTGAGCAACCCGCTGAGTGGAAGGTCATTGCCGATATCACATAATAATTG +ATCGAGTTAATCTGGAGGATCTGTTTACTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGATTT +GCCATCGAGCCTCCTTGGGAGTTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGGAGTTGTGCGCCA +AGTCATATGACACATAATTGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAAC +AACTCTCAGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGA +ATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCAC +GCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCATCCGGTGC +GGATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCATTTGATGGTCCTC +AAAACGGCAAGAGGTGGACGAACTATGCTACAACCAAATTGTTGTCCCAAGGCCCCGGGTTGTCGTATTA +GATGGGCCACCGTAACCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATG +ACCATGTGTTGCGACCCCAGTCAGCTGAGCAACGCGCTGAGCGTAACAAGGTTTCCGTAGGTGGACCTCC +GGGAGGATCATTGTTGAGATCACATAATAATTGATCGAGGTAATCTGGAGGATCTGCATATTTTGGTCAC +""" +_dna = "".join(_dna.splitlines()) +_dna = _dna * 25 +_dna_bytes = bytes_from_str(_dna) +_dna_unicode = unicode_from_str(_dna) + +def _get_dna(STR): + if STR is UNICODE: + return _dna_unicode + if STR is BYTES: + return _dna_bytes + raise AssertionError + +@bench('dna.count("AACT")', "count AACT substrings in DNA example", 10) +def count_aact(STR): + seq = _get_dna(STR) + seq_count = seq.count + needle = STR("AACT") + for x in _RANGE_10: + seq_count(needle) + +##### startswith and endswith + +@bench('"Andrew".startswith("A")', 'startswith single character', 1000) +def startswith_single(STR): + s1 = STR("Andrew") + s2 = STR("A") + s1_startswith = s1.startswith + for x in _RANGE_1000: + s1_startswith(s2) + +@bench('"Andrew".startswith("Andrew")', 'startswith multiple characters', + 1000) +def startswith_multiple(STR): + s1 = STR("Andrew") + s2 = STR("Andrew") + s1_startswith = s1.startswith + for x in _RANGE_1000: + s1_startswith(s2) + +@bench('"Andrew".startswith("Anders")', + 'startswith multiple characters - not!', 1000) +def startswith_multiple_not(STR): + s1 = STR("Andrew") + s2 = STR("Anders") + s1_startswith = s1.startswith + for x in _RANGE_1000: + s1_startswith(s2) + + +# endswith + +@bench('"Andrew".endswith("w")', 'endswith single character', 1000) +def endswith_single(STR): + s1 = STR("Andrew") + s2 = STR("w") + s1_endswith = s1.endswith + for x in _RANGE_1000: + s1_endswith(s2) + +@bench('"Andrew".endswith("Andrew")', 'endswith multiple characters', 1000) +def endswith_multiple(STR): + s1 = STR("Andrew") + s2 = STR("Andrew") + s1_endswith = s1.endswith + for x in _RANGE_1000: + s1_endswith(s2) + +@bench('"Andrew".endswith("Anders")', + 'endswith multiple characters - not!', 1000) +def endswith_multiple_not(STR): + s1 = STR("Andrew") + s2 = STR("Anders") + s1_endswith = s1.endswith + for x in _RANGE_1000: + s1_endswith(s2) + +#### Strip + +@bench('"Hello!\\n".strip()', 'strip terminal newline', 1000) +def terminal_newline_strip_right(STR): + s = STR("Hello!\n") + s_strip = s.strip + for x in _RANGE_1000: + s_strip() + +@bench('"Hello!\\n".rstrip()', 'strip terminal newline', 1000) +def terminal_newline_rstrip(STR): + s = STR("Hello!\n") + s_rstrip = s.rstrip + for x in _RANGE_1000: + s_rstrip() + +@bench('"\\nHello!".strip()', 'strip terminal newline', 1000) +def terminal_newline_strip_left(STR): + s = STR("\nHello!") + s_strip = s.strip + for x in _RANGE_1000: + s_strip() + +@bench('"\\nHello!\\n".strip()', 'strip terminal newline', 1000) +def terminal_newline_strip_both(STR): + s = STR("\nHello!\n") + s_strip = s.strip + for x in _RANGE_1000: + s_strip() + +@bench('"\\nHello!".rstrip()', 'strip terminal newline', 1000) +def terminal_newline_lstrip(STR): + s = STR("\nHello!") + s_lstrip = s.lstrip + for x in _RANGE_1000: + s_lstrip() + +@bench('s="Hello!\\n"; s[:-1] if s[-1]=="\\n" else s', + 'strip terminal newline', 1000) +def terminal_newline_if_else(STR): + s = STR("Hello!\n") + NL = STR("\n") + for x in _RANGE_1000: + s[:-1] if (s[-1] == NL) else s + + +# Strip multiple spaces or tabs + +@bench('"Hello\\t \\t".strip()', 'strip terminal spaces and tabs', 1000) +def terminal_space_strip(STR): + s = STR("Hello\t \t!") + s_strip = s.strip + for x in _RANGE_1000: + s_strip() + +@bench('"Hello\\t \\t".rstrip()', 'strip terminal spaces and tabs', 1000) +def terminal_space_rstrip(STR): + s = STR("Hello!\t \t") + s_rstrip = s.rstrip + for x in _RANGE_1000: + s_rstrip() + +@bench('"\\t \\tHello".rstrip()', 'strip terminal spaces and tabs', 1000) +def terminal_space_lstrip(STR): + s = STR("\t \tHello!") + s_lstrip = s.lstrip + for x in _RANGE_1000: + s_lstrip() + + +#### replace +@bench('"This is a test".replace(" ", "\\t")', 'replace single character', + 1000) +def replace_single_character(STR): + s = STR("This is a test!") + from_str = STR(" ") + to_str = STR("\t") + s_replace = s.replace + for x in _RANGE_1000: + s_replace(from_str, to_str) + +@uses_re +@bench('re.sub(" ", "\\t", "This is a test"', 'replace single character', + 1000) +def replace_single_character_re(STR): + s = STR("This is a test!") + pat = re.compile(STR(" ")) + to_str = STR("\t") + pat_sub = pat.sub + for x in _RANGE_1000: + pat_sub(to_str, s) + +@bench('"...text.with.2000.lines...replace("\\n", " ")', + 'replace single character, big string', 10) +def replace_single_character_big(STR): + s = _get_2000_lines(STR) + from_str = STR("\n") + to_str = STR(" ") + s_replace = s.replace + for x in _RANGE_10: + s_replace(from_str, to_str) + +@uses_re +@bench('re.sub("\\n", " ", "...text.with.2000.lines...")', + 'replace single character, big string', 10) +def replace_single_character_big_re(STR): + s = _get_2000_lines(STR) + pat = re.compile(STR("\n")) + to_str = STR(" ") + pat_sub = pat.sub + for x in _RANGE_10: + pat_sub(to_str, s) + + +@bench('dna.replace("ATC", "ATT")', + 'replace multiple characters, dna', 10) +def replace_multiple_characters_dna(STR): + seq = _get_dna(STR) + from_str = STR("ATC") + to_str = STR("ATT") + seq_replace = seq.replace + for x in _RANGE_10: + seq_replace(from_str, to_str) + +# This increases the character count +@bench('"...text.with.2000.newlines...replace("\\n", "\\r\\n")', + 'replace and expand multiple characters, big string', 10) +def replace_multiple_character_big(STR): + s = _get_2000_lines(STR) + from_str = STR("\n") + to_str = STR("\r\n") + s_replace = s.replace + for x in _RANGE_10: + s_replace(from_str, to_str) + + +# This decreases the character count +@bench('"When shall we three meet again?".replace("ee", "")', + 'replace/remove multiple characters', 1000) +def replace_multiple_character_remove(STR): + s = STR("When shall we three meet again?") + from_str = STR("ee") + to_str = STR("") + s_replace = s.replace + for x in _RANGE_1000: + s_replace(from_str, to_str) + + +big_s = "A" + ("Z"*128*1024) +big_s_bytes = bytes_from_str(big_s) +big_s_unicode = unicode_from_str(big_s) +def _get_big_s(STR): + if STR is UNICODE: return big_s_unicode + if STR is BYTES: return big_s_bytes + raise AssertionError + +# The older replace implementation counted all matches in +# the string even when it only neeed to make one replacement. +@bench('("A" + ("Z"*128*1024)).replace("A", "BB", 1)', + 'quick replace single character match', 10) +def quick_replace_single_match(STR): + s = _get_big_s(STR) + from_str = STR("A") + to_str = STR("BB") + s_replace = s.replace + for x in _RANGE_10: + s_replace(from_str, to_str, 1) + +@bench('("A" + ("Z"*128*1024)).replace("AZZ", "BBZZ", 1)', + 'quick replace multiple character match', 10) +def quick_replace_multiple_match(STR): + s = _get_big_s(STR) + from_str = STR("AZZ") + to_str = STR("BBZZ") + s_replace = s.replace + for x in _RANGE_10: + s_replace(from_str, to_str, 1) + + +#### + +# CCP does a lot of this, for internationalisation of ingame messages. +_format = "The %(thing)s is %(place)s the %(location)s." +_format_dict = { "thing":"THING", "place":"PLACE", "location":"LOCATION", } +_format_bytes = bytes_from_str(_format) +_format_unicode = unicode_from_str(_format) +_format_dict_bytes = dict((bytes_from_str(k), bytes_from_str(v)) for (k,v) in _format_dict.items()) +_format_dict_unicode = dict((unicode_from_str(k), unicode_from_str(v)) for (k,v) in _format_dict.items()) + +def _get_format(STR): + if STR is UNICODE: + return _format_unicode + if STR is BYTES: + if sys.version_info >= (3,): + raise UnsupportedType + return _format_bytes + raise AssertionError + +def _get_format_dict(STR): + if STR is UNICODE: + return _format_dict_unicode + if STR is BYTES: + if sys.version_info >= (3,): + raise UnsupportedType + return _format_dict_bytes + raise AssertionError + +# Formatting. +@bench('"The %(k1)s is %(k2)s the %(k3)s."%{"k1":"x","k2":"y","k3":"z",}', + 'formatting a string type with a dict', 1000) +def format_with_dict(STR): + s = _get_format(STR) + d = _get_format_dict(STR) + for x in _RANGE_1000: + s % d + + +#### Upper- and lower- case conversion + +@bench('("Where in the world is Carmen San Deigo?"*10).lower()', + "case conversion -- rare", 1000) +def lower_conversion_rare(STR): + s = STR("Where in the world is Carmen San Deigo?"*10) + s_lower = s.lower + for x in _RANGE_1000: + s_lower() + +@bench('("WHERE IN THE WORLD IS CARMEN SAN DEIGO?"*10).lower()', + "case conversion -- dense", 1000) +def lower_conversion_dense(STR): + s = STR("WHERE IN THE WORLD IS CARMEN SAN DEIGO?"*10) + s_lower = s.lower + for x in _RANGE_1000: + s_lower() + + +@bench('("wHERE IN THE WORLD IS cARMEN sAN dEIGO?"*10).upper()', + "case conversion -- rare", 1000) +def upper_conversion_rare(STR): + s = STR("Where in the world is Carmen San Deigo?"*10) + s_upper = s.upper + for x in _RANGE_1000: + s_upper() + +@bench('("where in the world is carmen san deigo?"*10).upper()', + "case conversion -- dense", 1000) +def upper_conversion_dense(STR): + s = STR("where in the world is carmen san deigo?"*10) + s_upper = s.upper + for x in _RANGE_1000: + s_upper() + + +# end of benchmarks + +################# + +class BenchTimer(timeit.Timer): + def best(self, repeat=1): + for i in range(1, 10): + number = 10**i + x = self.timeit(number) + if x > 0.02: + break + times = [x] + for i in range(1, repeat): + times.append(self.timeit(number)) + return min(times) / number + +def main(): + (options, test_names) = parser.parse_args() + if options.bytes_only and options.unicode_only: + raise SystemExit("Only one of --8-bit and --unicode are allowed") + + bench_functions = [] + for (k,v) in globals().items(): + if hasattr(v, "is_bench"): + if test_names: + for name in test_names: + if name in v.group: + break + else: + # Not selected, ignore + continue + if options.skip_re and hasattr(v, "uses_re"): + continue + + bench_functions.append( (v.group, k, v) ) + bench_functions.sort() + + p("bytes\tunicode") + p("(in ms)\t(in ms)\t%\tcomment") + + bytes_total = uni_total = 0.0 + + for title, group in itertools.groupby(bench_functions, + operator.itemgetter(0)): + # Flush buffer before each group + sys.stdout.flush() + p("="*10, title) + for (_, k, v) in group: + if hasattr(v, "is_bench"): + bytes_time = 0.0 + bytes_time_s = " - " + if not options.unicode_only: + try: + bytes_time = BenchTimer("__main__.%s(__main__.BYTES)" % (k,), + "import __main__").best(REPEAT) + bytes_time_s = "%.2f" % (1000 * bytes_time) + bytes_total += bytes_time + except UnsupportedType: + bytes_time_s = "N/A" + uni_time = 0.0 + uni_time_s = " - " + if not options.bytes_only: + try: + uni_time = BenchTimer("__main__.%s(__main__.UNICODE)" % (k,), + "import __main__").best(REPEAT) + uni_time_s = "%.2f" % (1000 * uni_time) + uni_total += uni_time + except UnsupportedType: + uni_time_s = "N/A" + try: + average = bytes_time/uni_time + except (TypeError, ZeroDivisionError): + average = 0.0 + p("%s\t%s\t%.1f\t%s (*%d)" % ( + bytes_time_s, uni_time_s, 100.*average, + v.comment, v.repeat_count)) + + if bytes_total == uni_total == 0.0: + p("That was zippy!") + else: + try: + ratio = bytes_total/uni_total + except ZeroDivisionError: + ratio = 0.0 + p("%.2f\t%.2f\t%.1f\t%s" % ( + 1000*bytes_total, 1000*uni_total, 100.*ratio, + "TOTAL")) + +if __name__ == "__main__": + main() |